shRNA Adeno-associated Virus Serotype 2, p7SK-(RBM33-shRNA-Seq3)(CAT#: AAV-SI3807WQ)

This product is a RBM33-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of RBM33-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert RBM33-shRNA-Seq3
Related Target/Protein RBM33
Region CDS
TargetSeq GAACTGTTGTTTCTCTTTCTT
NCBI RefSeq NM_053043
Alternative Names PRR8
Titer >1*10^10 GC/mL
Target Gene
Gene ID 155435
Uniprot ID Q96EV2

Related Products

Inquiry Now
Advertisement