shRNA Adeno-associated Virus Serotype 2, p7SK-(RNPS1-shRNA-Seq3)(CAT#: AAV-SI1053WQ)
This product is a RNPS1-shRNA encoding AAV, which is based on AAV-2 serotype. The RNPS1 gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. The expression of RNPS1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | RNPS1-shRNA-Seq3 |
Related Target/Protein | RNPS1 |
Region | CDS |
TargetSeq | TCTGTCCAAAGGCTATGCGTA |
NCBI RefSeq | NM_006711 |
Alternative Names | E5.1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Neuro-developmental disorders |