shRNA Adeno-associated Virus Serotype 2, p7SK-(WDR46-shRNA-Seq3)(CAT#: AAV-SI1497WQ)
This product is a WDR46-shRNA encoding AAV, which is based on AAV-2 serotype. The WDR46 gene is required for localization of DDX21 and NCL to the granular compartment of the nucleolus. The expression of WDR46-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | WDR46-shRNA-Seq3 |
Related Target/Protein | WDR46 |
Region | CDS |
TargetSeq | CTTCAGAAACAGGGTTTCTAA |
NCBI RefSeq | NM_005452 |
Alternative Names | UTP7; BING4; FP221; C6orf11 |
Titer | >1*10^10 GC/mL |
Related Diseases | Respiratory Disease |