shRNA Adeno-associated Virus Serotype 2, p7SK-(Zfp36l2-shRNA-Seq1)(CAT#: AAV-SI3977WQ)
This product is a Zfp36l2-shRNA encoding AAV, which is based on AAV-2 serotype. The Zfp36l2 gene is a member of the TIS11 family of early response genes. The expression of Zfp36l2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Zfp36l2-shRNA-Seq1 |
Related Target/Protein | Zfp36l2 |
Region | CDS |
TargetSeq | CAAACCTCAATCTGAACAACA |
NCBI RefSeq | NM_001001806 |
Alternative Names | BRF2; ERF2; ERF-2; TIS11D; RNF162C |
Titer | >1*10^10 GC/mL |
Related Diseases | T-cell acute lymphoblastic leukemia (T-ALL) |