shRNA Adeno-associated Virus Serotype 2, pH1-(FAM49B-shRNA-Seq2)(CAT#: AAV-SI0677WQ)

This product is a FAM49B-shRNA encoding AAV, which is based on AAV-2 serotype. FAM49B is a regulator of mitochondrial function and integrity and also inhibits T-cell activation by repressing RAC1 activity and modulating cytoskeleton reorganization. The expression of FAM49B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert FAM49B-shRNA-Seq2
Related Target/Protein FAM49B
Region CDS
TargetSeq GCAAATCGAATGTCTTTGTTT
NCBI RefSeq NM_016623
Alternative Names L1; BM-009
Titer >1*10^10 GC/mL
Related Diseases Pancreatic ductal adenocarcinoma (PDAC)
Target Gene
Gene ID 51571
Uniprot ID Q9NUQ9

Related Products

Inquiry Now
Advertisement