shRNA Adeno-associated Virus Serotype 2, pH1-(Med25-shRNA-Seq1)(CAT#: AAV-SI3071WQ)

This product is a Med25-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Med25 gene plays a role in chromatin modification and in preinitiation complex assembly. Mutations in this gene are associated with Charcot-Marie-Tooth disease type 2B2. The expression of Med25-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Med25-shRNA-Seq1
Related Target/Protein Med25
Region CDS
TargetSeq GCAGCTGTTCGATGACTTTAA
NCBI RefSeq NM_029365
Alternative Names P78; ACID1; ARC92; BVSYS; PTOV2; CMT2B2; TCBAP0758
Titer >1*10^10 GC/mL
Related Diseases Charcot-Marie-Tooth disease type 2B2
Target Gene
Gene ID 81857
Uniprot ID Q71SY5

Related Products

Inquiry Now
Advertisement