shRNA Adeno-associated Virus Serotype 2, pU6-(C6orf141-shRNA-Seq2)(CAT#: AAV-SI0309WQ)
This product is a C6orf141-shRNA encoding AAV, which is based on AAV-2 serotype. Low C6orf141 Expression is Significantly Associated with a Poor Prognosis in Patients with Oral Cancer. The expression of C6orf141-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | C6orf141-shRNA-Seq2 |
| Related Target/Protein | C6orf141 |
| Region | CDS |
| TargetSeq | GATTATCAGGTAACACAAGAA |
| NCBI RefSeq | NM_153344 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Oral Cancer |
