shRNA Adeno-associated Virus Serotype 2, pU6-(Erc1-shRNA-Seq1)(CAT#: AAV-SI2336WQ)

This product is a Erc1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Erc1 gene is a member of a family of RIM-binding proteins. RIMs are active zone proteins that regulate neurotransmitter release. The expression of Erc1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Erc1-shRNA-Seq1
Related Target/Protein Erc1
Region CDS
TargetSeq GCAGATAAAGAACGGACGATT
NCBI RefSeq NM_053204
Alternative Names ELKS; Cast2; ERC-1; RAB6IP2
Titer >1*10^10 GC/mL
Related Diseases Thyroid papillary carcinoma
Target Gene
Gene ID 23085
Uniprot ID Q8IUD2

Related Products