shRNA Adeno-associated Virus Serotype 2, pU6-(LRRC18-shRNA-Seq2)(CAT#: AAV-SI0207WQ)
This product is a LRRC18-shRNA encoding AAV, which is based on AAV-2 serotype. The LRRC18 gene may be involved in the regulation of spermatogenesis and sperm maturation. The expression of LRRC18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | LRRC18-shRNA-Seq2 |
| Related Target/Protein | LRRC18 |
| Region | CDS |
| TargetSeq | CCAATCTGATCTCACCCAATT |
| NCBI RefSeq | NM_001006939 |
| Alternative Names | UNQ933; UNQ9338; VKGE9338 |
| Titer | >1*10^10 GC/mL |
