shRNA Adeno-associated Virus Serotype 2, pU6-(PRR14-shRNA-Seq1)(CAT#: AAV-SI0432WQ)

This product is a PRR14-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by PRR14 gene tethers heterochromatin to the nuclear laminar scaffold by binding heterochromatin protein 1 (HP1) and the nuclear lamina. The expression of PRR14-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert PRR14-shRNA-Seq1
Related Target/Protein PRR14
Region CDS
TargetSeq CGATTCAGAATACGCAGAACA
NCBI RefSeq NM_024031
Titer >1*10^10 GC/mL
Related Diseases Lung cancer
Target Gene
Gene ID 78994
Uniprot ID Q9BWN1

Related Products