Close

Magic™ Membrane Protein Human FXYD3 (FXYD domain containing ion transport regulator 3) expressed in E.coli for Antibody Discovery (CAT#: MP1381J)

This product is a 20.5 kDa Human FXYD3 membrane protein expressed in E.coli. The protein is for research use only and is not approved for use in humans or in clinical diagnosis.

Product Specifications

  • Host Species
  • Human
  • Target Protein
  • FXYD3
  • Protein Length
  • Partial (21-38aa)
  • Protein Class
  • Ion Channel
  • Molecular Weight
  • 20.5 kDa
  • Sequence
  • AATGACCTAGAAGATAAAAACAGTCCTTTCTACTATGACTGGCACAGCCTCCAG

Product Description

  • Expression Systems
  • E.coli
  • Tag
  • N-6xHis-SUMO
  • Reconstitution
  • Please reconstitute protein in deionized sterile water to a concentration of 0.1-1.0 mg/mL.We recommend to add 5-50% of glycerol (final concentration).
  • Purity
  • >85% as determined by SDS-PAGE
  • Buffer
  • Liquid: Tris/PBS-based buffer, 5%-50% glycerol
    Lyophilized powder: Tris/PBS-based buffer, 6% Trehalose, pH 8.0

Target

  • Target Protein
  • FXYD3
  • Full Name
  • FXYD domain containing ion transport regulator 3
  • Introduction
  • This gene belongs to a small family of FXYD-domain containing regulators of Na+/K+ ATPases which share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD, and containing 7 invariant and 6 highly conserved amino acids. This gene encodes a cell membrane protein that may regulate the function of ion-pumps and ion-channels. This gene may also play a role in tumor progression. Alternative splicing results in multiple transcript variants encoding distinct isoforms.
  • Alternative Names
  • Chloride conductance inducer protein Mat 8; Chloride conductance inducer protein Mat-8; FXYD domain containing ion transport regulator 3; FXYD domain-containing ion transport regulator 3; Fxyd3; FXYD3_HUMAN; Mammary tumor 8 kDa protein; MAT-8; MAT8; MGC111076; Phospholemman like; Phospholemman-like; PLML

Customer reviews and Q&As    

Related Products
Online Inquiry
CONTACT US
USA:
Europe:
Germany:
Call us at:
USA:
UK:
Germany:
Fax:
Email:
Our customer service representatives are available 24 hours a day, 7 days a week. Contact Us
© 2024 Creative Biolabs. | Contact Us