shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(BTBD9-shRNA-Seq1)(CAT#: AdV-SI1415WQ)
This product is a BTBD9-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The BTBD9 gene encodes a BTB/POZ domain-containing protein. This domain is known to be involved in protein-protein interactions. The expression of BTBD9-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | BTBD9-shRNA-Seq1 |
| Related Target/Protein | BTBD9 |
| Region | CDS |
| TargetSeq | CCGTACATGATTGGGTCAATA |
| NCBI RefSeq | NM_152733 |
| Alternative Names | dJ322I12.1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Tourette Syndrome |
