shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Cenpc1-shRNA-Seq2)(CAT#: AdV-SI3440WQ)
This product is a Cenpc1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Cenpc1 gene is a centromere autoantigen and a component of the inner kinetochore plate. The encoded protein is required for maintaining proper kinetochore size and a timely transition to anaphase. The expression of Cenpc1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Cenpc1-shRNA-Seq2 |
Related Target/Protein | Cenpc1 |
Region | CDS |
TargetSeq | CAGGTAATCATTACAACATTA |
NCBI RefSeq | NM_007683 |
Alternative Names | MIF2; hcp-4; CENP-C; CENPC |
Titer | >1*10^10 GC/mL |