shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(CREG2-shRNA-Seq1)(CAT#: AdV-SI1235WQ)

This product is a CREG2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. Human and mouse CREG2 are putative secreted glycoproteins and may be novel neuronal extracellular molecules. The expression of CREG2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert CREG2-shRNA-Seq1
Related Target/Protein CREG2
Region CDS
TargetSeq CAGTATTTCAAGGGAGGAATA
NCBI RefSeq NM_153836
Titer >1*10^10 GC/mL
Related Diseases Brain disease
Target Gene
Gene ID 200407
Uniprot ID Q8IUH2

Related Products