shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(HEATR2-shRNA-Seq1)(CAT#: AdV-SI1387WQ)

This product is a HEATR2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by HEATR2 gene is essential for the preassembly or stability of axonemal dynein arms, and is found only in organisms with motile cilia and flagella. The expression of HEATR2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert HEATR2-shRNA-Seq1
Related Target/Protein HEATR2
Region CDS
TargetSeq CGACTGATCTCATGCCGTATT
NCBI RefSeq NM_017802
Alternative Names CILD18; DNAAF5
Titer >1*10^10 GC/mL
Related Diseases Primary ciliary dyskinesia-18
Target Gene
Gene ID 54919
Uniprot ID Q86Y56

Related Products