shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C1orf138-shRNA-Seq2)(CAT#: AdV-SI0639WQ)

This product is a C1orf138-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of C1orf138-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C1orf138-shRNA-Seq2
Related Target/Protein C1orf138
Region 3UTR
TargetSeq CGGATGCTCACATTTCTCTTT
NCBI RefSeq NM_001025493
Alternative Names ADAMTSL4-AS1
Titer >1*10^10 GC/mL
Related Diseases Multiple sclerosis
Target Gene
Gene ID 574406
Uniprot ID Q5T5F5

Related Products