shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(LRRC18-shRNA-Seq1)(CAT#: AdV-SI0707WQ)
This product is a LRRC18-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The LRRC18 gene may be involved in the regulation of spermatogenesis and sperm maturation. The expression of LRRC18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | LRRC18-shRNA-Seq1 |
| Related Target/Protein | LRRC18 |
| Region | CDS |
| TargetSeq | CCGGGACAACCTGAATAGAAT |
| NCBI RefSeq | NM_001006939 |
| Alternative Names | UNQ933; UNQ9338; VKGE9338 |
| Titer | >1*10^10 GC/mL |
