shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(MICALCL-shRNA-Seq2)(CAT#: AdV-SI0586WQ)

This product is a MICALCL-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The MICALCL gene may cooperate with MAPK1/ERK2 via an intracellular signal transduction pathway in the morphogenetic development of round spermatids to spermatozoa and act as Rab effector protein and play a role in vesicle trafficking. The expression of MICALCL-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert MICALCL-shRNA-Seq2
Related Target/Protein MICALCL
Region CDS
TargetSeq CAAAGCAGACTGGAGCAGAAA
NCBI RefSeq NM_032867
Alternative Names Ebitein1
Titer >1*10^10 GC/mL
Related Diseases Renal cancer
Target Gene
Gene ID 84953
Uniprot ID Q6ZW33

Related Products