shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(MICALCL-shRNA-Seq2)(CAT#: AdV-SI0586WQ)
This product is a MICALCL-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The MICALCL gene may cooperate with MAPK1/ERK2 via an intracellular signal transduction pathway in the morphogenetic development of round spermatids to spermatozoa and act as Rab effector protein and play a role in vesicle trafficking. The expression of MICALCL-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | MICALCL-shRNA-Seq2 |
| Related Target/Protein | MICALCL |
| Region | CDS |
| TargetSeq | CAAAGCAGACTGGAGCAGAAA |
| NCBI RefSeq | NM_032867 |
| Alternative Names | Ebitein1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Renal cancer |
