shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(C14orf70-shRNA-Seq1)(CAT#: AdV-SI0488WQ)

This product is a C14orf70-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of C14orf70-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C14orf70-shRNA-Seq1
Related Target/Protein C14orf70
Region CDS
TargetSeq GAACCTGAAAGACGAGGAGAA
NCBI RefSeq NM_001007560
Alternative Names LINC00523
Titer >1*10^10 GC/mL
Related Diseases Type 2 diabetes
Target Gene
Gene ID 283601
Uniprot ID Q86TU6

Related Products