shRNA Lentivirus (self-inactivating), p7SK-(OR10C1-shRNA-Seq2)(CAT#: LV-SI3285WQ)

This product is a OR10C1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR10C1 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR10C1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert OR10C1-shRNA-Seq2
Related Target/Protein OR10C1
Region CDS
TargetSeq CCTTGGAGATTGGCTATACGT
NCBI RefSeq NM_013941
Alternative Names OR10C2; OR6-31; OR10C1P; hs6M1-17
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 442194
Uniprot ID Q96KK4

Related Products