shRNA Lentivirus (self-inactivating), pH1-(C3orf15-shRNA-Seq2)(CAT#: LV-SI0960WQ)
This product is a C3orf15-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C3orf15 gene may play a role in spermatogenesis and regulate cilium motility through its role in the assembly of the axonemal radial spokes. The expression of C3orf15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | C3orf15-shRNA-Seq2 |
Related Target/Protein | C3orf15 |
Region | 3UTR |
TargetSeq | CCTGATTCAAAGACTGTCAAA |
NCBI RefSeq | NM_033364 |
Alternative Names | AAT1; CFAP91; MAATS1; CaM-IP2; SPATA26; AAT1alpha |
Titer | >1*10^10 GC/mL |
Related Diseases | Kartagener syndrome |