shRNA Lentivirus (self-inactivating), pH1-(CEP76-shRNA-Seq1)(CAT#: LV-SI0738WQ)

This product is a CEP76-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The CEP76 gene encodes a centrosomal protein which regulates centriole amplification by limiting centriole duplication to once per cell cycle. The expression of CEP76-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert CEP76-shRNA-Seq1
Related Target/Protein CEP76
Region CDS
TargetSeq CACATTTAAAGGGTTCCCAAT
NCBI RefSeq NM_024899
Alternative Names C18orf9; HsT1705
Titer >1*10^10 GC/mL
Related Diseases Centriole reduplication
Target Gene
Gene ID 79959
Uniprot ID Q8TAP6

Related Products