shRNA Lentivirus (self-inactivating), pU6-(COG6-shRNA-Seq1)(CAT#: LV-SI2289WQ)
This product is a COG6-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The COG6 gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi apparatus. The expression of COG6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | COG6-shRNA-Seq1 |
| Related Target/Protein | COG6 |
| Region | CDS |
| TargetSeq | CGTGGAGATATTGAACGTAAA |
| NCBI RefSeq | NM_020751 |
| Alternative Names | COD2; SHNS; CDG2L |
| Titer | >1*10^10 GC/mL |
