shRNA Adeno-associated Virus Serotype 2, p7SK-(C1qtnf3-shRNA-Seq1)(CAT#: AAV-SI3571WQ)

This product is a C1qtnf3-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of C1qtnf3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C1qtnf3-shRNA-Seq1
Related Target/Protein C1qtnf3
Region CDS
TargetSeq GCAATCAGAACAGTGGCATTA
NCBI RefSeq NM_030888
Alternative Names CORS; CORCS; CTRP3; CORS26; C1ATNF3; CORS-26
Titer >1*10^10 GC/mL
Target Gene
Gene ID 114899
Uniprot ID Q9BXJ4

Related Products