shRNA Adeno-associated Virus Serotype 2, p7SK-(C3orf15-shRNA-Seq3)(CAT#: AAV-SI1462WQ)

This product is a C3orf15-shRNA encoding AAV, which is based on AAV-2 serotype. The C3orf15 gene may play a role in spermatogenesis and regulate cilium motility through its role in the assembly of the axonemal radial spokes. The expression of C3orf15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C3orf15-shRNA-Seq3
Related Target/Protein C3orf15
Region 3UTR
TargetSeq CCAGTAAGGAAGCAACTAAAT
NCBI RefSeq NM_033364
Alternative Names AAT1; CFAP91; MAATS1; CaM-IP2; SPATA26; AAT1alpha
Titer >1*10^10 GC/mL
Related Diseases Kartagener syndrome
Target Gene
Gene ID 89876
Uniprot ID Q7Z4T9

Related Products

Inquiry Now
Advertisement