shRNA Adeno-associated Virus Serotype 2, p7SK-(FAM171A1-shRNA-Seq1)(CAT#: AAV-SI1189WQ)
This product is a FAM171A1-shRNA encoding AAV, which is based on AAV-2 serotype. The FAM171A1 gene is involved in the regulation of the cytoskeletal dynamics and plays a role in actin stress fiber formation. The expression of FAM171A1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | FAM171A1-shRNA-Seq1 |
Related Target/Protein | FAM171A1 |
Region | CDS |
TargetSeq | CGCTCACGTTAGACATTCATA |
NCBI RefSeq | NM_001010924 |
Alternative Names | APCN; C10orf38 |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer |