shRNA Adeno-associated Virus Serotype 2, pH1-(4930412M03Rik-shRNA-Seq1)(CAT#: AAV-SI2568WQ)

This product is a 4930412M03Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 4930412M03Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert 4930412M03Rik-shRNA-Seq1
Related Target/Protein 4930412M03Rik
Region CDS
TargetSeq CATCATGCAATTGTGATTATT
NCBI RefSeq NM_177098
Titer >1*10^10 GC/mL
Target Gene
Gene ID 100504140
Uniprot ID Q8CDU0

Related Products

Inquiry Now
Advertisement