shRNA Adeno-associated Virus Serotype 2, pH1-(Cyhr1-shRNA-Seq1)(CAT#: AAV-SI3198WQ)

This product is a 1700120K04Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 1700120K04Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Cyhr1-shRNA-Seq1
Related Target/Protein Cyhr1
Region CDS
TargetSeq GCAGCTCTACAACAGCATCTT
NCBI RefSeq NM_019396
Alternative Names CHRP
Titer >1*10^10 GC/mL
Target Gene
Gene ID 50626
Uniprot ID Q6ZMK1

Related Products

Inquiry Now
Advertisement