shRNA Adeno-associated Virus Serotype 2, pH1-(Lamtor2-shRNA-Seq1)(CAT#: AAV-SI3196WQ)

This product is a Lamtor2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Lamtor2 gene is highly conserved with a mouse protein associated with the cytoplasmic face of late endosomes and lysosomes. The expression of Lamtor2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Lamtor2-shRNA-Seq1
Related Target/Protein Lamtor2
Region CDS
TargetSeq GCTGAATAATGAGGGATCGCT
NCBI RefSeq NM_031248
Alternative Names p14; ENDAP; ROBLD3; HSPC003; MAPBPIP; MAPKSP1AP; Ragulator2
Titer >1*10^10 GC/mL
Related Diseases Primary immunodeficiency syndrome
Target Gene
Gene ID 28956
Uniprot ID Q9Y2Q5

Related Products