shRNA Adeno-associated Virus Serotype 2, pH1-(MUM1L1-shRNA-Seq1)(CAT#: AAV-SI0955WQ)

This product is a MUM1L1-shRNA encoding AAV, which is based on AAV-2 serotype. The MUM1L1 gene encodes a protein which contains a mutated melanoma-associated antigen 1 domain. The expression of MUM1L1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert MUM1L1-shRNA-Seq1
Related Target/Protein MUM1L1
Region CDS
TargetSeq CACATCCGTTTGAAACAGGAA
NCBI RefSeq NM_152423
Alternative Names MUM1L1
Titer >1*10^10 GC/mL
Related Diseases Endometrial carcinoma
Target Gene
Gene ID 139221
Uniprot ID Q5H9M0

Related Products

Inquiry Now
Advertisement