shRNA Adeno-associated Virus Serotype 2, pH1-(PRRC2A-shRNA-Seq2)(CAT#: AAV-SI0895WQ)

This product is a PRRC2A-shRNA encoding AAV, which is based on AAV-2 serotype. The PRRC2A gene has microsatellite repeats which are associated with the age-at-onset of insulin-dependent diabetes mellitus (IDDM) and possibly thought to be involved with the inflammatory process of pancreatic beta-cell destruction during the development of IDDM. The expression of PRRC2A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert PRRC2A-shRNA-Seq2
Related Target/Protein PRRC2A
Region CDS
TargetSeq CCACAATCCAAGAACCTGGAT
NCBI RefSeq NM_004638
Alternative Names G2; BAT2; D6S51; D6S51E
Titer >1*10^10 GC/mL
Related Diseases Insulin-dependent diabetes mellitus (IDDM)
Target Gene
Gene ID 7916
Uniprot ID P48634

Related Products