shRNA Adeno-associated Virus Serotype 2, pU6-(BC052040-shRNA-Seq1)(CAT#: AAV-SI2343WQ)

This product is a BC052040-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of BC052040-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert BC052040-shRNA-Seq1
Related Target/Protein BC052040
Region CDS
TargetSeq CCACCCTCCAAGTCTGTTATA
NCBI RefSeq NM_207264
Titer >1*10^10 GC/mL
Target Gene
Gene ID 399568
Uniprot ID E9PWV4

Related Products