shRNA Adeno-associated Virus Serotype 2, pU6-(C12orf32-shRNA-Seq2)(CAT#: AAV-SI0399WQ)

This product is a C12orf32-shRNA encoding AAV, which is based on AAV-2 serotype. The C12orf32 gene plays a role in DNA damage response (DDR) signaling upon genotoxic stresses such as ionizing radiation (IR) during the S phase. The expression of C12orf32-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C12orf32-shRNA-Seq2
Related Target/Protein C12orf32
Region CDS
TargetSeq CCCGAGGACAAGTATGGAATA
NCBI RefSeq NM_031465
Alternative Names RHINO; RHNO1; HKMT1188
Titer >1*10^10 GC/mL
Related Diseases DNA damage response (DDR)
Target Gene
Gene ID 83695
Uniprot ID Q9BSD3

Related Products

Advertisement