shRNA Adeno-associated Virus Serotype 2, pU6-(Ccdc43-shRNA-Seq1)(CAT#: AAV-SI2210WQ)

This product is a Ccdc43-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Ccdc43-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Ccdc43-shRNA-Seq1
Related Target/Protein Ccdc43
Region CDS
TargetSeq CATCGCCACCTTGATTGAGAA
NCBI RefSeq NM_025918
Titer >1*10^10 GC/mL
Target Gene
Gene ID 124808
Uniprot ID Q96MW1

Related Products

Inquiry Now
Advertisement