shRNA Adeno-associated Virus Serotype 2, pU6-(LRRC18-shRNA-Seq1)(CAT#: AAV-SI0206WQ)

This product is a LRRC18-shRNA encoding AAV, which is based on AAV-2 serotype. The LRRC18 gene may be involved in the regulation of spermatogenesis and sperm maturation. The expression of LRRC18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert LRRC18-shRNA-Seq1
Related Target/Protein LRRC18
Region CDS
TargetSeq CCGGGACAACCTGAATAGAAT
NCBI RefSeq NM_001006939
Alternative Names UNQ933; UNQ9338; VKGE9338
Titer >1*10^10 GC/mL
Target Gene
Gene ID 474354
Uniprot ID Q8N456

Related Products

Advertisement