shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(TMEM205-shRNA-Seq1)(CAT#: AdV-SI1342WQ)

This product is a TMEM205-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. Elevated expression of TMEM205, a hypothetical membrane protein, is associated with cisplatin resistance. The expression of TMEM205-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert TMEM205-shRNA-Seq1
Related Target/Protein TMEM205
Region CDS
TargetSeq CTGATTAAGATGGTCCATCTA
NCBI RefSeq NM_198536
Alternative Names UNQ501
Titer >1*10^10 GC/mL
Related Diseases Ovarian cancer
Target Gene
Gene ID 374882
Uniprot ID Q6UW68

Related Products