shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(2010110P09Rik-shRNA-Seq6)(CAT#: AdV-SI2082WQ)

This product is a 2010110P09Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of 2010110P09Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert 2010110P09Rik-shRNA-Seq6
Related Target/Protein 2010110P09Rik
Region CDS
TargetSeq CCTAAACAGCAGAATGAACAA
NCBI RefSeq XM_355937
Alternative Names Cbhp2; Chp2
Titer >1*10^10 GC/mL
Target Gene
Gene ID 70261
Uniprot ID Q9D869

Related Products