shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Fdx1-shRNA-Seq1)(CAT#: AdV-SI2249WQ)

This product is a Fdx1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Fdx1 gene encodes a small iron-sulfur protein that transfers electrons from NADPH through ferredoxin reductase to mitochondrial cytochrome P450, involved in steroid, vitamin D, and bile acid metabolism. The expression of Fdx1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Fdx1-shRNA-Seq1
Related Target/Protein Fdx1
Region CDS
TargetSeq GCCATTACTGATGAAGAGAAT
NCBI RefSeq NM_007996
Alternative Names ADX; FDX; LOH11CR1D
Titer >1*10^10 GC/mL
Target Gene
Gene ID 2230
Uniprot ID P10109

Related Products