shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Fdx1-shRNA-Seq1)(CAT#: AdV-SI2249WQ)
This product is a Fdx1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Fdx1 gene encodes a small iron-sulfur protein that transfers electrons from NADPH through ferredoxin reductase to mitochondrial cytochrome P450, involved in steroid, vitamin D, and bile acid metabolism. The expression of Fdx1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Fdx1-shRNA-Seq1 |
Related Target/Protein | Fdx1 |
Region | CDS |
TargetSeq | GCCATTACTGATGAAGAGAAT |
NCBI RefSeq | NM_007996 |
Alternative Names | ADX; FDX; LOH11CR1D |
Titer | >1*10^10 GC/mL |