shRNA Lentivirus (self-inactivating), pH1-(Atxn7l1-shRNA-Seq5)(CAT#: LV-SI2710WQ)

This product is a Atxn7l1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Atxn7l1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Atxn7l1-shRNA-Seq5
Related Target/Protein Atxn7l1
Region CDS
TargetSeq CGAGAAGTTAGACTGTCAGTT
NCBI RefSeq NM_001033436
Alternative Names ATXN7L4
Titer >1*10^10 GC/mL
Target Gene
Gene ID 222255
Uniprot ID Q9ULK2

Related Products