shRNA Lentivirus (self-inactivating), pH1-(C4orf37-shRNA-Seq3)(CAT#: LV-SI0835WQ)

This product is a C4orf37-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C4orf37 gene may be associated with male factor infertility. The expression of C4orf37-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C4orf37-shRNA-Seq3
Related Target/Protein C4orf37
Region CDS
TargetSeq CGACAGGTAGTAATGCACCAT
NCBI RefSeq NM_174952
Alternative Names STPG2
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 285555
Uniprot ID Q8N412

Related Products