shRNA Lentivirus (self-inactivating), pU6-(C12orf48-shRNA-Seq1)(CAT#: LV-SI0272WQ)

This product is a C12orf48-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C12orf48 is required to suppress inappropriate homologous recombination, thereby playing a central role DNA repair and in the maintenance of genomic stability. The expression of C12orf48-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C12orf48-shRNA-Seq1
Related Target/Protein C12orf48
Region CDS
TargetSeq CAAACTAGCTAAAGTAGCAAA
NCBI RefSeq NM_017915
Alternative Names AROM; PARI; PARPBP
Titer >1*10^10 GC/mL
Related Diseases Hepatocellular Carcinoma
Target Gene
Gene ID 55010
Uniprot ID Q9NWS1

Related Products