shRNA Lentivirus (self-inactivating), pU6-(Mepe-shRNA-Seq1)(CAT#: LV-SI2304WQ)

This product is a Mepe-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Mepe gene encodes a secreted calcium-binding phosphoprotein that belongs to the small integrin-binding ligand, N-linked glycoprotein (SIBLING) family of proteins. The expression of Mepe-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Mepe-shRNA-Seq1
Related Target/Protein Mepe
Region CDS
TargetSeq GCTCCAGCAAAGCTGAAGTTA
NCBI RefSeq NM_053172
Alternative Names OF45
Titer >1*10^10 GC/mL
Related Diseases Aging-related trabecular bone loss
Target Gene
Gene ID 56955
Uniprot ID Q9NQ76

Related Products