shRNA Adeno-associated Virus Serotype 2, p7SK-(Nudcd1-shRNA-Seq1)(CAT#: AAV-SI3549WQ)

This product is a Nudcd1-shRNA encoding AAV, which is based on AAV-2 serotype. The Nudcd1 gene may be a suitable target for antigen-specific immunotherapy. The expression of Nudcd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Nudcd1-shRNA-Seq1
Related Target/Protein Nudcd1
Region CDS
TargetSeq GGCAGCACATGGACAATTAAA
NCBI RefSeq NM_026149
Alternative Names CML66; OVA66
Titer >1*10^10 GC/mL
Related Diseases Solid tumors
Target Gene
Gene ID 84955
Uniprot ID Q96RS6

Related Products