shRNA Adeno-associated Virus Serotype 2, p7SK-(Srbd1-shRNA-Seq4)(CAT#: AAV-SI3463WQ)

This product is a Srbd1-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Srbd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Srbd1-shRNA-Seq4
Related Target/Protein Srbd1
Region CDS
TargetSeq GATTCCTATCCGGTTCATAAC
NCBI RefSeq XM_001479682
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55133
Uniprot ID Q8N5C6

Related Products

Inquiry Now
Advertisement