shRNA Adeno-associated Virus Serotype 2, pH1-(Sval3-shRNA-Seq1)(CAT#: AAV-SI2744WQ)

This product is a Sval3-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Sval3 gene has the aspartic-type endopeptidase activity. The expression of Sval3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Sval3-shRNA-Seq1
Related Target/Protein Sval3
Region CDS
TargetSeq CAATAGAAACAAGTCACTTTC
NCBI RefSeq NM_001003952
Titer >1*10^10 GC/mL
Target Gene
Gene ID 387564
Uniprot ID Q76I99

Related Products

Advertisement