shRNA Adeno-associated Virus Serotype 2, pH1-(TMEM156-shRNA-Seq1)(CAT#: AAV-SI0660WQ)

This product is a TMEM156-shRNA encoding AAV, which is based on AAV-2 serotype. TMEM156 is expressed in several tissues including ascites, bone marrow, salivary glands, and vascular to name a few. It should be noted this gene is not ubiquitously expressed, but is still evident in many tissues. This gene is predominately expressed in adults but there is a bit of expression in fetuses. The expression of TMEM156-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert TMEM156-shRNA-Seq1
Related Target/Protein TMEM156
Region CDS
TargetSeq GAAGTGTGTTTGCAATCTAAT
NCBI RefSeq NM_024943
Titer >1*10^10 GC/mL
Related Diseases Breast cancer, liver cancer and prostate cancer
Target Gene
Gene ID 80008
Uniprot ID Q8N614

Related Products

Inquiry Now
Advertisement