shRNA Adeno-associated Virus Serotype 2, pU6-(TMEM44-shRNA-Seq1)(CAT#: AAV-SI0465WQ)
This product is a TMEM44-shRNA encoding AAV, which is based on AAV-2 serotype. TMEM44 gene encodes a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. The expression of TMEM44-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | TMEM44-shRNA-Seq1 |
Related Target/Protein | TMEM44 |
Region | CDS |
TargetSeq | CGCTGCTTCTCTATCTGAGAT |
NCBI RefSeq | NM_138399 |
Titer | >1*10^10 GC/mL |