shRNA Adeno-associated Virus Serotype 2, p7SK-(GLOD4-shRNA-Seq2)(CAT#: AAV-SI1145WQ)
This product is a GLOD4-shRNA encoding AAV, which is based on AAV-2 serotype. Transfection of GLOD4 gene in hepatocellular carcinoma cells and overexpression can inhibit the cell growth. The expression of GLOD4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | GLOD4-shRNA-Seq2 |
Related Target/Protein | GLOD4 |
Region | 3UTR |
TargetSeq | CGAGCTTCTTTCTGTGTATAT |
NCBI RefSeq | NM_016080 |
Alternative Names | HC71; CGI-150; C17orf25 |
Titer | >1*10^10 GC/mL |
Related Diseases | Hepatocellular carcinoma |